Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D165D04
Clone ID D165D04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD165D04
Sequence
AGTTATTGTTTTTTTAAGGCCACTTTAACTGAACTGTGGATGATGGTTAATCAGAAAGGCCCAGCCCAACAACGTGAAAG
CTCACAGCCAAAAGGATGAGCTAAAAAAGTTCCTGTGTTCTGGGTG
Sequence Type genomic DNA
Unitrap ID UNI27228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 120324907..120325032 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031843 (Mphosph6) NM_026758 M phase phosphoprotein 6 Gene [Source:MGI Symbol;Acc:MGI:1915783]


SPLK-Sequence tag 3SD165D04
Sequence
AAGTAACAGCTGAAAAGACTGGTCATCTGGCCCCAGAGCTTCTGCTTTGTATGATTAGCCTGTAGCACCTGTCTCTAACA
CANNNNGAGCTTGATTTACACGCCTGACNNNACAGTATTATAAACATGTGTTTAACAGAGCTGTCCTACCTACCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031843


For any suggestions or comments, please send an email to unitrap@crg.es