Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D165A04
Clone ID D165A04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD165A04
Sequence
ATAGTAGTGAGTCCATGATAAGAAATAACCATCTCATGATAAATATCAGTTCAGCTCAGTAAGTATATCCTGCTCTTTTT
ATAGAGTGAGAAACGGACGTTTTAAGGAGTGATTTGGGCTAGTGTCGTA
Sequence Type genomic DNA
Unitrap ID UNI10749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70795893..70796021 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018446 (C1qbp) NM_007573 complement component 1, q subcomponent binding protein Gene [Source:MGI (curated);Acc:C1qbp-001]

 
Come back to gene ENSMUSG00000018446


For any suggestions or comments, please send an email to unitrap@crg.es