Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D164H06
Clone ID D164H06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD164H06
Sequence
GATCTGGGAGCTTTAGAAGCTGAGCTGGGTTGAGGGCCAGTCAACCTTTGCTCTTTCTGCCTGAATCTCTTTAGGGTCCC
TATGCAGTTGCTAGGGTCTCAGGAGATCATTTGCTTTTTCGGCGTGGTTGC
Sequence Type genomic DNA
Unitrap ID UNI29570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 85041075..85041205 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006369 (Fbln1) NM_010180 fibulin 1 Gene [Source:MGI Symbol;Acc:MGI:95487]

 
Come back to gene ENSMUSG00000006369


For any suggestions or comments, please send an email to unitrap@crg.es