Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D164F11
Clone ID D164F11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD164F11
Sequence
ACCTCTTCAGGCAGGCCTGCTCTAACTAGTTACGGTCTTTTCCCTGTCTGCCCAAACTGTGTCAGCTTCCTGACAAGTCT
CTATAAAGAATGCTTGAAATAATTCTTACGATTACCACAACAGAAAATCATTTCTCATCTTAGAAGAGATATCATTTTCC
AAGCCTAAATAGTAAAAGCATTTTGAAAATACGGGAAACAAGAAGTGTTCTATAATAACAAAGCAGTTTCTGAGCCCAGA
GGATGATCGACATCCTAAGGCTCCTTAAGTCATACTGTACTGGGGGTGCGGTGGAGAGGCAAGCACCCAGGTGCAGGGCC
AACTCACTGTCACAG
Sequence Type genomic DNA
Unitrap ID UNI19047

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21679598..21679932 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035171 (1110059E24Rik) NM_025423 RIKEN cDNA 1110059E24 gene Gene [Source:MGI Symbol;Acc:MGI:1913456]


SPLK-Sequence tag 3SD164F11
Sequence
ATCGTTACCATGCATGTGGGGGATGGAGGAACAGGAAGGAGATGGAAAACATCGACTACAGTTCAGGCTTTACCACCTTC
AAAGTCTGCATTCTT
Sequence Type genomic DNA
Unitrap ID UNI19047

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21679500..21679594 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035171 (1110059E24Rik) NM_025423 RIKEN cDNA 1110059E24 gene Gene [Source:MGI Symbol;Acc:MGI:1913456]

 
Come back to gene ENSMUSG00000035171


For any suggestions or comments, please send an email to unitrap@crg.es