Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D164F10
Clone ID D164F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD164F10
Sequence
GATCCCCAGAGGTGGAGTTACAGATGGTCATGAGCCACCTAA
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109152852..109152893 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]


SPLK-Sequence tag 3SD164F10
Sequence
AGCTTGTTCAATTCCAAACAATAAGTCAGTATTTAGGAAAACAAAGCATTCCATGAGTCAGGATAAGATGCCTGATGCCC
CTTCTGAACCATGCTGCCCGTTCTCATGGGTAGGAGATTTACAGTATCATTTGCTGTCTAGTCCATATTCAAACACCCCC
AACTATCCCAAGAATGTTTTATTTAGTGTAGGAACTTAAACGCAAGGCATCTCAGACATGACCTCCAATTCTGTACAGTC
AAGAATGTAAAGAAGGGGAGGTAGTCCTGCCTTTGATCAGCCTGCCTATCCCTCTTTCTTCTCCCTCTTGGGGGTTGAGC
CAGGAAGCATCTTATTGGATTATAGGAGTCAAGATTCTGGTTTTGTGTTTTTAAGCACATGGATTTCATATAAGCTACAT
CTATGCGCACAAATAGCCACACACAGAGCTCAAGTTTGTAATTTAAAAAGACATATAATGTCTCCCCCTGTAATAAAGGC
AAGCTGGCGTTTCTGG
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109152973..109153468 496
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es