Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D067E10
Clone ID D067E10
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D067E10
Sequence
ACAGAATCTCATCNNNGGATTTCTAGACATTGAAGAAAATGAGAACAGTGGGAAATTTCTTCGACGGTATTTCATCCTGG
ATACCAGAGAAGACAGCTTTGTATGGTACATGGATAATCCACAGAACCTGCCTTCAGGATCGTCACGGGTTGGAGCCATT
AAACTTACCTACATTTCAAAGGTTAGCGATGCAACTAAGTTAAGGCCAAAGGCAGAGTTTTGTTTTG
Sequence Type mRNA
Unitrap ID UNI10418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138021285..138028962 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]


SPLK-Sequence tag 3SD067E10
Sequence
TTCTTTAAATTTTCCATTCATATAAAAGTACAATTGATGACAGGCTTG
Sequence Type genomic DNA
Unitrap ID UNI10418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138033422..138033469 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]

 
Come back to gene ENSMUSG00000040268


For any suggestions or comments, please send an email to unitrap@crg.es