Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D164C05
Clone ID D164C05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD164C05
Sequence
ACAGACATTTAAGAATTTCTGAGNNNNCAACTTAGTCAAAATTTTTAAAAATACAGCACAGAATTCTTTCTTCTCCACCA
GTCTACTAAAGATTCTCAGATTTGGGTCCTGGTTGGTGACATTCAAGAGAGGCCTCATTCTGAACGATGTTTGCACTGTG
TGGAAGGAAGGCAAGCTGGCAGAAGTGTTTTTCTAGGAAGTTGCGAACTCTCTTTCCTTTGACTTTGAAAATATCTGATT
ACTTGGGCCAAGTGCTGGCTGTGAAGGGTTTTCTTGTATCCTGCTCACTTATGAAAATTTGATATGGTGCTCGCAGCGTG
AAAAACAAGTCAGATGGAAATGGTTACTGTGAAAAGTGTTCCCTAGTTTGTGTACAACTTAAAAGAAAATGCTAGTTAGG
CCTGTCTGTTATTCAGACCTGAGGTGAATAAATACTTGTTATGCCCCCATTATTTTGACCTGAGTTTTTATTTGGAAAAT
TAAGTGTTTAGGAAGGTAACCCCTAAACTTGCTAGCTAATTCCTCCCCCGCTAGAAAAATGTCTCCCCTCTTGATTTAGT
TCCAAGCCCAGCTCTTACCAGTGGTTGACTGATTTTGTTGAAGATTTGAGGTCATTGTAGAACAGGGAGTTTTCTTTTCA
TGGATATTTTTGCATTGAAAGATTTCAATGCCGGTG
Sequence Type genomic DNA
Unitrap ID UNI25115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22437519..22438193 654
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


SPLK-Sequence tag 3SD164C05
Sequence
TTTAGAAATTGCTCAGATGGCAGCTAATCTTTGTAGGTTGCCATGGAGATGCTGTGTCATTTCAGGTATACACACCTGTT
TGGACAGACGGGTTGGGTTTAAATAAAGAATTGTGTGAGTGTGTGTGAAGAAAGTATACTTTTGATCAGTTTGTTCCTGG
AACTGTACTTAGTATTTTTACCATATACCTACAAAATGCATTTGAGACACACCATGCATTTGGAACATGGAACACCCAAT
TTCTCTAGTTCCTATCATAAAGTGGCAAATCTTAATTAAAAACTTATCTTAAAAAATAAAACAA
Sequence Type genomic DNA
Unitrap ID UNI25115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22437106..22437409 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es