Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D067E08
Clone ID D067E08
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D067E08
Sequence
CGGAGCGGGAGCGGGTGGAGGATCTGTTTGAGTACGAAGGGTGCAAAGTGGGACGCGGCACCTACGGGCATGTCTACAAG
GCGAGGCGGAAAGATGG
Sequence Type mRNA
Unitrap ID UNI10419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40069431..40069527 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038481 (Cdc2l6) NM_198164 cell division cycle 2-like 6 (CDK8-like) Gene [Source:MGI Symbol;Acc:MGI:1925584]


SPLK-Sequence tag 3SD067E08
Sequence
CAAGAGAAAAATAAATTATTTGTGGATAACTGGAGGTAAGTATTGTTAGTATTTTGTTTTATTTTCTTATAGTGTATATT
AAAAAATACATGCACAATATGCTTTTTTCTAATAAGGTAGAATCTAAATAACAAAATTCATAATTCTGTGTAGCTAGGTG
GGAAACTGAGGCAAGAGGATC
Sequence Type genomic DNA
Unitrap ID UNI10419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40085211..40085391 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038481 (Cdc2l6) NM_198164 cell division cycle 2-like 6 (CDK8-like) Gene [Source:MGI Symbol;Acc:MGI:1925584]

 
Come back to gene ENSMUSG00000038481


For any suggestions or comments, please send an email to unitrap@crg.es