Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D163C05
Clone ID D163C05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD163C05
Sequence
ATAAGAGAAAATGTGCGATTCCTTTAGCGTGTACAACATGACTGTGAGGATAAGAAGAGCAGCTTTTCTGAGAGCCCGTA
GATTTTTTTTTTTTAGCGATAAGTAGATGGCATTTCTTCTGTGTTTGGTGCTGATCACAGCGGGCTCTTGTTCCATCTTT
AGATAGTTCTTCATGCTCTGCTGTTTCATTCCCAAGGGGCCCCAGGCTTCAGGGTTGTGCTTTGGGGATTGTCTGAGGGC
ATCCTGTTAGGATTTCTGCTGCTTCAGCAGCCAGGCCAGGCTGTGCACTGTGTGCCCTGCCTGCTAAACAACAAGTCTGA
GAACTGCTGTTCTCCATTTAGCAAAACCCAGGAAGTCAGCTCACCTCAGACTACAGACTGAATAAACTAAGGAGCTGAAA
ACCAGCTGTCAGCATTTGCTGGAAAGCCCGGACTCGATGCTGTGATTCCGCAGGGCAGAGGCTCCACGTTAAAGCAATTT
ATGCATGATGT
Sequence Type genomic DNA
Unitrap ID UNI29991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126757734..126758224 487
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031977 (Galnt2) NM_139272 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:894694]

 
Come back to gene ENSMUSG00000031977


For any suggestions or comments, please send an email to unitrap@crg.es