Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D162E07
Clone ID D162E07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD162E07
Sequence
TCAAGGTCATGGTCAGCTGGGCTGTGAGAGACTGTCTCAAAATGGAAGAAAAAAAGCAGGGAGGT
Sequence Type genomic DNA
Unitrap ID UNI22196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98052281..98052345 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018160 (Med1) NM_001080118 methyl-CpG binding domain protein 4 Gene [Source:MGI (curated);Acc:Med1-004]

 
Come back to gene ENSMUSG00000018160


For any suggestions or comments, please send an email to unitrap@crg.es