Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D161G05
Clone ID D161G05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD161G05
Sequence
AGATAAGGATACTATTTATTTTCTAAAAAAGAAAGGTTTTTCATTGTAAATATTTGTATTTGNNNATTTTCATACATAAT
GATAATGATAGTATAGTGTGTACACAGGTGCCTTCTGTTGGGACTCACCATTGTTAATATTTGGTTCTGTTTGCTTNNNT
CATGTATGAAGTTTTCGAGTTCACCCACTGCAGCTGTAAGATATCTCACAGGAAGGACTCAGGAACAATTCTGTACCTAA
GTGGTGACATAAATATTAATGTAGTTATCTATTCAGGCTCAAGTTTACTACTTGTGCCCAAGTTATATTTTTCATCTTGT
TTATTTAAATCAGGTACATGTATAACATTTCTGAAATCACTCTTTTATTCATAAC
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30901890..30902264 359
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]


SPLK-Sequence tag 3SD161G05
Sequence
TACTAGGCTACAGTGTTGAGAGAGAATCTCGTCTTTAGGACTTCACTATATCTTGCATTGGTTACTATCATGCATGGTTA
CTCCCAATTTCAATGTGAAAGATTTCCTGATATGCAGTTTCCCCAAAATAAATTCTTAAAAAAGAGGTTAGTTTGAAAAT
TAAGTTGTTGATAATGTTTGCTTAAAAATATTTTCTAGCATTAGGATCAATATTGATAATAAATTTGATGCAAACGACTG
GGATTGGTGAATAGTGTTCACTACTCTCACAGTAGTGAAGATAACACACCATCTGAAAACCATAGCTTTGTTAGGATGAA
TACTCAGTTTCTCATCAGATTTCCCTTTAATGGGTTCTAAGCCTCCATAGGCAGTGCTTGCTGGCATCAGTTATAACCAC
TGGCTAGTTTCTCGTTATTTTAATTCATGTGTATTTGCTGAATTTTACAAAATTAAAATTTCTTTATCACCTACAAGGTA
GTATGCAGTTCTTATAGATGGGACTGTTGAAAAGGACAAACAGCATTTAGTCAACAATTTCAGAATTGATGTTGGTGAAG
TAGTTATATCCAACATCATGCAGTGGGCCTCCTATCCTTTTTGATTGTCACAAAGACTGTGG
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30900770..30901392 619
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es