Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D161F07
Clone ID D161F07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD161F07
Sequence
TCCCACCCCCAGCAGCCATTACCAGCCACTGGAGCCTTTTAACTGTATTCCTCCTATTTGGCTGTTGTGTGTTTGGGGAT
AAATAAATAGTAGAGTGAA
Sequence Type genomic DNA
Unitrap ID UNI7052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22049301..22049399 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]


SPLK-Sequence tag 3SD161F07
Sequence
TATTTCCCGGTTTCCTCTGAAACTTTCATGTGCTGGTGTTTGGGGATACTTCCTGATCCCACTAAGGACTGCAGCAATCT
CCACTGGCGAATGGTGACCCCTTTGCCACCTTCTCTGGACCATACATGGAGCTTATATTGCTTTACTTCTTAAAATACAC
TTCACATGACTGGAACTGGCAGTTTTCCTGTGCAAGTTATTTTGTATTTTTCTCTGGAATTCATTGGTGACCATGTCATG
TGATGATTTTTACTCTTTTGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es