Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D067B05
Clone ID D067B05
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D067B05
Sequence
GCTCCGAGTCTCCAGCCTGCCGAGAGCTGAAGCGATCCTCCCTCTGTGTCTTNNNCAGCCCNNNGCCTCGCCGCCTCTCA
GTCTCCTCAGAGTCGCCCTCTCTCGCCGCCGCCGCCATGAACGGGCAGCTCAACGGCTTCCACGAGGCGTTCATTGAGGA
GGGGACGTTCCTCTTCACTTCCGAGTCTGTAGGGGAAGGTCACCCAG
Sequence Type mRNA
Unitrap ID UNI1329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72389340..72389546 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053907 (Mat2a) NM_145569 methionine adenosyltransferase II, alpha Gene [Source:MGI Symbol;Acc:MGI:2443731]


SPLK-Sequence tag 5SD067B05
Sequence
GTAAATACTAATATTCAGTTTGAGCTGTTTCCGTTCGCAGGGGGTCCACAGCAATATTATTACATGGCTTGTGAGGAGCA
TCTTGATGAGGAATGAGTCAAAGGCAAACGCTACTGGGGCTCCTCCCACACTCCCCTCAAGGAAAGGAGTATCTCCATAT
CTATTGAATCACTCCTTAGTACAGCCATTAGATTCCATCTTAAGGTTCTGTGGCTGCAATACACATTTTGGGGTAGTAAC
AAAAATCAAGGAACATAGAGCCAAGCACAGTGGTACACTAACTACTTCAATCCCAGCGTTTTAAGTATGGAAGAAACTGA
GGTCGACACTATTGGCCACGTGTAAGACCCTGTCTCAATACCACAAACATTCCAGACCAGGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD067B05
Sequence
GCTTCAGGAATGGATATGGCTAGAGCCACNTGNAAAGTTTCCTGGAGCCGAGAGAGNACACAGTGTGGATTTTCTCGTGA
GTCCCGGGCAGGCCGGGCCATATACCCCGGCTCTCAAAAAAAAAAATTTCGCGGCTTTTTTGTTTGCGGGGGGGTTCTCT
CCGGAAATTTTTTTTCCGGGGTAAAAAAAAAACCCCCTTCCCCCTTTGGCCAAAAAAGGGGGAAAGGGCCTGTTTTAAGA
AGTTAATGCCCCGCCCGGGGGCCCTTTAGGGGGGTTGGAACCTTTTAAAGGGGGGGGGAAAAAAGAACCGGTGCCCCCAA
AAAACCCGGGGGGGGTTTTTCCTTGGGGGGGCTTTGGGAATCCCAAAAAAACCCTTTTGGCTTTGGTAAACCCGGGGGGG
GGGGGGGGGGGGGCCCCCCTGGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053907


For any suggestions or comments, please send an email to unitrap@crg.es