Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D161C09
Clone ID D161C09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD161C09
Sequence
GATCCAGAAGTCAGTGATGTCTTTGAGATACTGCCAAGATTCTTCTTGTAGAGAATGTTATGGGAAACTAAACTCTGAAT
TCAAATACCTGACACGCCGAAACACGATGTGCGTGCGGGGGTGGGTTGGGGTGTGTACCTCCGTGGTAACTACACAGCGG
CCATTTCCCGACTCCAGAAGGAGAGGAAGCAAGATTGTCTTTCATATAAGAAGCATCTTGACTGGATAAAATGTCTTACA
TTTTT
Sequence Type genomic DNA
Unitrap ID UNI21111

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21195088..21195332 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044968 (Napepld) NM_178728 N-acyl phosphatidylethanolamine phospholipase D Gene [Source:MGI Symbol;Acc:MGI:2140885]

 
Come back to gene ENSMUSG00000044968


For any suggestions or comments, please send an email to unitrap@crg.es