Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D160A01
Clone ID D160A01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD160A01
Sequence
GGGGACTTCCAGTTTTTTATTTCTCTGGGAGTTTTTCT
Sequence Type genomic DNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75497639..75497675 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]

 
Come back to gene ENSMUSG00000049764


For any suggestions or comments, please send an email to unitrap@crg.es