Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D159H07
Clone ID D159H07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD159H07
Sequence
GATCTAGCTTGGGAAGGNNNCTTAGAACCAGCCGTAGGAAGGATTCCGGTGGGCCAGCTACATGGGCGTGGGGAGGAGAG
CTGCACCGACTGAGGGGCTTGCCGCTTTTGTCTTTTCTCTTTGTCCAGAGAACCTTATGTAAGAACTCTTCTTGGAAAAC
AGGAAAGTTCCAGCTTGCCAAGTTCAGCACAGGGAGTAGTGCAGGCCTGGTTTCCAACACACCCGGCCCAGCCTTAACCC
CGGCACCCAGCCGGTTTTCTTGTCCCTGGTTCTCCACCCTGCANNCCCCTAAACCCCTTTTTATCTTCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD159H07
Sequence
ATCTCCAGTCACCCCTAACAAACCTCCTCAAAG
Sequence Type genomic DNA
Unitrap ID UNI30001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69499204..69499236 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es