Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D159E08
Clone ID D159E08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD159E08
Sequence
CAAGCAGTGATGGATTCCTGTGCCAGTTAGAACGTGTCGTGGAGGTGAAGGAACCAGTAGGCTCCAAGGAGCCTTTTCAG
CATTCAGCCCCAACATCTTAGGCTCCTGGCATCTGCCTTCCCGGGTCTGTGTCCGTTTTACCATTGGCGAGTTGGCACTT
CTTGTGTGGGAGGCACAGGTTGAATGATAATGTCTTTCCTTTCCTCCTTGGTTCCAGCAAGCAAGGAGTCCAAGTTATCC
Sequence Type genomic DNA
Unitrap ID UNI29787

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35518032..35518271 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es