Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D159B07
Clone ID D159B07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD159B07
Sequence
GGGTTACGGGACTCGGCTCGTGCCCAAGCCTCTCTAAAGGGCCGAAAGAACCCTGGGGGACAATAAGTGTCGGAGAATGA
GGAACAAGCGACACAATTCCACTCGGGAGCTCAGCTTTGAATTTGCAGACTGCTGGGACCTCACTATACAAGTCGGCAGG
GCGCTGAGAATGTTTTTCTTCTAGTTTTTAATCAGTGCCCAGTAGTGTGAATGCAGCCTCTCTGCTGAGACTTGACAATG
CAATGCGATCTGGAGTTCCCACGGCAACAGAACTAACTCGTCCCAGGGCTCTTTGAGTTATCAGTCGGCCCACATTTCAC
AAAGGTGATCAGCGTGGGCTCGACAGCTCTTAGAGGCCTTTTCTGAAAGCAGGCCGCGTATGCACTACCTGTCGGTCCCC
CTTTTGGATTCAAACCTCTGGAGCATTCCTGTTTGCCGAACACAATTGAATGGTCCAGCTTTTTTGTGCTGACTGAGGTG
TGGTGTAAGTTGGGGTTCGCTGTAAAGGGCGTAGGGTCTCTGGGCCAGCTGGTGAGTAAGAGCGTNNNATGTTTAAGATC
CC
Sequence Type genomic DNA
Unitrap ID UNI9659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116960891..116961451 554
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es