Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D158F06
Clone ID D158F06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD158F06
Sequence
GATCTATTTTTAACATAATTACCATTATCATCTTGGGCATTGCTGTCATTTTACAGAACACATTAAACAAAATGCTGTGA
TCAGGTAATGAAGAAGCAAAGCCGAGTAAGGAGTGACCACATGCTCTGGGGCATGGTGATGGCGTCCAGGCTGGCCAGCA
AAAACTTAAAGGCCCAGAAATCAAACATGCTAGTTAAAAAGAGATAGTGGTTTAATGTTTACTAACATTGAAATCACACA
CACACAAATATTTTTGAAACTCAGAGCCACACAACCAAGATTAGAATCCCATCC
Sequence Type genomic DNA
Unitrap ID UNI14064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96607344..96607637 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]


SPLK-Sequence tag 3SD158F06
Sequence
CCTTGCTATAAGCTGTATAGTGCTAGGACTCTGGCCTAACTCACCTGAGCCTCAGCGTCTCCTTTTGGAAACATCACTCC
ATAGCTGCATGGACATCACATGAAGGAAAGTGAGTTGGTGTGTATGAGAGCGTTTGTAAGTGAGATAGGACCACCAGGAT
GGATACAGCTGGGCGCTTTTGCCTTTGTTGTGTTTGAGTCCACAAAGTTGGCCTTTGGAAGGAGTCAGGATGGGGAAGGA
GGTATTTTGCTTGGTAAGCAGATATTGGAGCTGAAACAATCACAGGCTGTCTGGATTCCATAGCTGGGCAGAGCACAAGG
ATGCTGCGATCACAAGATGCTGGGGCTGGGTTTGAGAGGACGGAGGTGGAAGGAAATTGGTCCAACACTTGTTGAGACAG
CGAGTGCAGAGTGCGTTGTTTGTATGGCTTTGCACTCACTCTGCTAAAAGGAGCAGCCGAGCTGCAGGTCACTCGCTCCA
GGTATTGTGAGACCTTTTTCTTCTCTCCTCCTGAGGCTGTTCCTGCAGCTCTGAAGCTTCCTGG
Sequence Type genomic DNA
Unitrap ID UNI14064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96606802..96607345 544
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es