Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D158E05
Clone ID D158E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD158E05
Sequence
AATTGGTTTGGTGAATAAGTAAATGTCTAGTTAACATGGACAAAGTCATGAATCTGAGTGCTCTCCAAGCATGAGATGTC
AACAGACATGATACCCAAGGGCTGCTTGCATTCTCTTTGGGGGTTGCCGATATTGTGTCTGGAAGCAGGGGTGTTCTTCC
CTGAATTCCATCTCCTTCTGTGCTTCGTCCTCTTCTCGACATGCAGGGTTCTGTGGCGATTGTGTTAGGAAACCAGCCAC
ATGCGGGGGGTCTTCATAGAAACGTGGGGCTGAGCTTGAGGAAAAGGGGAGTGGTTAGCAGGAGGAGCTTTCTGCTGATG
GCCCTGGAGCCTGCTGTGCAAGCTTAGGTTATAACACCACTTTCTCTGTCTAGAAGGACCAAGGGCCTGCCTGTTTCCTC
AGCTCCTCTGTGTGCCACTATTTACAGGGAAAACATCACTGGGGCCTTTCCAGATGGTGGCTTTCTGGACTCGAGGAGAG
CCAAATCTGCACAGACCCTGGCCAGAGGCCCAGAGGCCCAGAGAATCTGCCAGGCACTGGGACTTGTGTTGGCCTTTCTG
CGCCACCACCTGGGCTTCTGCATGGTTGGTCCCTGAGCTT
Sequence Type genomic DNA
Unitrap ID UNI30004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103904524..103905123 594
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034751 (Mast4) microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:1918885]

 
Come back to gene ENSMUSG00000034751


For any suggestions or comments, please send an email to unitrap@crg.es