Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D157F11
Clone ID D157F11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD157F11
Sequence
TCAAAACTGAGAAACATGGGTAAAAGAGAGTGCCCCTCAGGAGGCGGGAGGCAGCATAACTGTGGAGTCCCTCACTTTGT
GGAGCACTTTCAACAGCCTAAGTCACTAACCCACAGCTTTGTGGTGGCATCTNNNNCTCACAGGATCAGGCTAATGCCTA
TAGGAGCGTCACTATGGGGACGGGCCTCTAGCTTTGTGTAGAAGCCCCATAGCCTCTTCCACCCAAGTCAGTTCAGTCAT
AGCTGACCTTAAGGTTGGGGTGCTTGGGAATACTTATTCTAGAGCAGCATGGCCCTGGCACTGAGGCACCGTGATCCTTC
TGGGTGCCCTTATTGGGAGCTGAGGCTGCACCACACCCATGTGAGAGGGATAGGGAGGATGGGGAATCCCTCCTGTGAGT
TAGAGACACACAAGCTGTGTAGACAAGGAAGTCAGGCCTATTCAAGAGGGTAGGGTAGCTATGCTTGTCCATCCTGTCCC
ATCTGTCTGTCTGTTTTCACACAGACATGTACTAGGTGAGAAAGGCGACATCTGAAAGCAGTCCCTTAGGAAACAAAGGG
GCCCTGCAGGTCTGATGTCCTC
Sequence Type genomic DNA
Unitrap ID UNI3517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72445302..72445881 556
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


SPLK-Sequence tag 3SD157F11
Sequence
TTTGGCTTATGTGCCATGGGGCTAATGAATGCCAACACAGGCCATTCCAAAGGTCAGAGGTCCATTGAAGGGTGATAGAG
ACAGATCATGGCTAGCCAGGGCTTGGTGGACAGACTTGTGAGTCAAGCTAGTCTGTGTTGTGGTGCAAGGTTTGGGTGCA
GAAGAGTAGGTGTATAGGCCATGACAGCCAAGCTGGCCCTGAGGAGGACTTGGTCCTCAGTTGATGTAGGTGTTCTTCCT
CCTCCGATCAGATTGAGGAGACATGGATAGGATCC
Sequence Type genomic DNA
Unitrap ID UNI3517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72445026..72445300 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es