Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065H11
Clone ID D065H11
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D065H11
Sequence
AGTGAGAAATTCCTACTCCAGGCGCTGCCCAGCCCCCTGTCAGTGAGGGCTGAGCCCCCGCAG
Sequence Type mRNA
Unitrap ID UNI4648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 46673733..46673783 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047731 (D19Wsu162e) NM_146099 Outcome predictor in acute leukemia 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8BGW2]

 
Come back to gene ENSMUSG00000047731


For any suggestions or comments, please send an email to unitrap@crg.es