Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D157D05
Clone ID D157D05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD157D05
Sequence
TTCCTTCATGCATATGGAGTTTTTTGGAAAAAAAAATGGTATTTTAATGCTTTCTATTAAATTGGGACTAAAAGTGGTGT
CTTAATTTGCATGCATTAGCATATTTGCATATAGATCACTGAAATGGTGGAAGAGAGAAGAGCCTTT
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148230482..148230628 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


SPLK-Sequence tag 3SD157D05
Sequence
CTCTCGCTGTGGCAGTTATACTTGAGCTTTCCCTGCACCTACAGCCCGACCTTGTGTCTTGATCGCCCCGGGAATACGTT
ACTGACCAACACTCGGAGATGTCTCTCTGGGGACTTAGAGACTGGCAAGCCCCAGTTCTTGGTCACCACAGCCCTGTGGC
TTCCTAGTGTAGCCAGGACTCAAGTTGGCCTGTCCCAGAGGTGGCTGTGCGGGGAGGGGCTTGCATCTACCACCAACAGA
CTGTGGGCCTGGGTCCCTGGGCCTCTGCAAGCCTTTGTCCTCCCACAACTTGGGTTTTCTCCTCTCACCCTTCCTAGGCT
ATGTTTTGTGCTATGGGTCTACTGTAGACACGGGTGCTCCCTGCGACTTTCCTGGGCTTATAGCCTGGCTTTGTACCAAA
GGAGGGGAGGGGGCAGGTGGAGTGGTCTGCTTCTGCTGGTTCTCCCTCTGCCAGCTTCCCCTTCCCACCCTCTTGACACA
GAAGGCCCAGGCTGCTGTGTCTCCTTTATCGTTTAGGCCTCCAGTTGTTTAAATGTCACCTCTTCAGACTGCCTAAAGTC
ACCCCACATATTCCTCAGTCACTCTCTCTGTTTGCCCTCCAAGAACTTGTGTTTCGTCGATTCCGTGGTTAACGTCCCTT
TTCCAGCACTCCCATCCTTGCCTGGGTTAAAGCCGGAGCTCCCCGTCCATCTCGCTTAACCAATGCTTAAGACAGAGGTT
GGGCATGTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es