Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D156B09
Clone ID D156B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD156B09
Sequence
TGCAGTTTTTTGTTTATATAAAATGAGTGATTTAGTCACTGAGGGAATGAGGGTTGCTCACAAAGCTCCTCCCACCAGTG
GTTCTTGTCACCTATAGCTGGGGCTCCTGGCTTCTCAACAGTTAAGAAAGTTGTAGCCTTTCTGTTATTTACATGGGAAA
TCATGTGGCTTTGAGCAATCACTCTACACTCACATGAGATACACATGGGTCAGCCCTAAAAGCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD156B09
Sequence
CTCTTGGTTCAATATCCAGTACTAGGTAGGGTACGTGATTGTGGGATTGAATAGTGTA
Sequence Type genomic DNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142915645..142915702 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es