Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D156B03
Clone ID D156B03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD156B03
Sequence
GATCCCTGTTATTTCTTAGATATAATTAGTTGCATTGGAATTCCTCATTTTGCTTTCAGTTTGTAGTCTTTATAGTGCTC
TGGTTCTTTGGGGGTAGGTAGTGTCTGCTGAAATGTGCATGCCACATTGTATGGAGGACAGTTTTGGAAATTGAAA
Sequence Type genomic DNA
Unitrap ID UNI21706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100403252..100403407 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]


SPLK-Sequence tag 3SD156B03
Sequence
CAGAACGTGGTTGAGTAGGTCGCTCGACATTTTGATTGAAAATCTCAGGTTAGCNNTTTGTCAGGCCAGTACACAGCTGN
NCTCGAAGACGTCANNNTGGGAGGTGTCGTACAATCGTGTGGACATTGTTCTCTGCTGTTTGAGAAGGGGATCACACATG
TCTTTAAAATATTGGAGAGTATGCTAGAAACTCCAGTGTTACTGGAACAGTTTGAACATTGCTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es