Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D156A05
Clone ID D156A05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD156A05
Sequence
CCCAATTTTTTTTTTCCCCCAAATTTACCCCCCCAAAAAAAATTTTTTTTTAAAAAAAAAGGGGTTCCCCCAATTTGGGG
TCCCCCCCCTTTTCCTTCCGGAGGGGGGGGGAAAAAGGGGGGGCCCCCCCCCCCCCCCTTTTTTTTTTTTTTTTTTTTAA
TATTTGTCAAATTTCAGGTATTATAGGAACAGGGACTTAATCTAGGGTCCTCCATTTTATTCCATTGATAAATGTGTCTG
TTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD156A05
Sequence
TTTTATTCTGTTAACATGCTGGTTTTTAGTTCTTACAGCTATGTCTAACTTGAAAGCAAACATTTTACGTTTACTAGTGC
ATATGTTAGTATTTCTTCACTCATTTTCCTGTT
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22403329..22403441 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es