Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D155G11
Clone ID D155G11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD155G11
Sequence
ACACAGCTCTTCCTTGATATCTCCCCCCCCCCACATACATACACATAGACTTTTGTTCATACATATAAATGAAAATAAAT
CAGGAAGAAAGGGAATGACTGATAGACACTGCCTCCTTTGTCTAAACTTTGGTCTTCTAACTAGAATTGTGTGTCTATTA
TACCTTCTCACTGTTTCCTCTTGGGGGAAGGGGAGGATCGTGGCACCTGAGATTGTCAGCCATTTCTCAGTTGACATATT
GGGAAAGGGGTGTTCTTATGACCTCCAGTCTTGCCTGGGAAGAAATCTTTAACACTTCCACATTTGATTTTAACTAAGTG
ATAGGAAATCCTG
Sequence Type genomic DNA
Unitrap ID UNI30010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105123925..105124257 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]


SPLK-Sequence tag 3SD155G11
Sequence
TATGAGCTTTATGCTCTACATCANNNNTAGTTGAAGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es