Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D155E04
Clone ID D155E04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD155E04
Sequence
AGATATCATGACAGCAAAGATCAAACTTGTCCCAAGGAACTTGATGCCCAAAATCTTTAGGAAGTTGTCTAATGATGTCA
CCCCTTTTCTGACCCCTGCCTTTATTTGGAGATTTCTTTCCTTTTCTCTCTATCCCTTTCCCCCACCTCTTAACTACTGT
TAGGGGGTTGAAAGGGTAGAAGAAAAGGGATGGAGAAGGGAGGAAGAAAGAACCCACAAAGTAGTAATACAGGCAACTGC
AATCTTCTACAAATCTCGAAACAACTATGCCACCAGAGTTAGAGAAGGGATGGCCCAGGGTTACAAGATCACCCTCAGCT
TTCCAGTAGTCATACAGCATATGCCTGCTAACGGTGTGGAAAAAGGTTATGCTGAGATAAGATGGCATCCTATAGAAATG
ATACATC
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21160538..21160944 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


SPLK-Sequence tag 3SD155E04
Sequence
AGTAGACTGTGACCACGCTGCTTAAAGTCTCAG
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21161248..21161280 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es