Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065G04
Clone ID D065G04
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D065G04
Sequence
CCGCCCAGCCAACCCCTGCCTGCCGGNNNCTCGCCCATCCACACTAGCCTGCTTGACATGAGGAGGAACGTGGCTGAACT
CAGGCTCCAACTCCAGCAGATGAGGCAGCTCCAGCTGCAGNNNCAGGAGATTCTGAGGGCGATGATGAAGAAGGCTGAGC
TGGAAATCAGTAACAAAGTGAAGGAGACCATGAAGAGACTAGAGGATCCGGTACAGCGTCAGCGCACCCTGGTGGAGCAA
GAGAGACAGAAGTACCTCCACGAAGAAGAGCGGATTGTCAAAAAGTTATG
Sequence Type mRNA
Unitrap ID UNI10426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20688125..20699828 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


SPLK-Sequence tag 5SD065G04
Sequence
GATCTCTAAGTTCTTAGTTGTGAGAGAAGAGAGACANNNATTAATGATGGGACAGTCAGGTACACTAGAGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD065G04
Sequence
TGGATGTCTAAAGTGAGCTAACACACTTCACTGTAGTACTGGGTCATACCCCCCTCTTAGGCTACCCCCAGCCCCAATAG
TGTGGACACCTGTCACATTATGACGCATCTCTCCCCTCTGTCTTTCTCTCCCTCCATTCCTGGCCACCAAGTGTGCACAT
GGCTCTCTTGACTGGCATGAATACAACTGACAGATAAGAATGTATCAAGTGCCCACTCCACCCCCACCCGGGACCAATCT
GAATCACAAATGAGAGACGCGGCAGAGCTCTCCCGCTGCTACCTTACATAGCCATGCAATATTGCAANNNAGACTACTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es