Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D155D01
Clone ID D155D01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD155D01
Sequence
CGCGGGGTCTGCCTGCGGCTCTCCTGCGGGCGGTGCACGCGAGCCGTGGAGCCGTGGTTCGAGGCGACCTCCCTCACCAT
GCCCGAGATTAGGGTCACTCCCTTGGGTGAGTCCGAGTCCTAAGCATCTTCCGCGGCGTCCGGAGAGTCGGATGGGTCCC
TTCATCTCCGTAGCCGTTTGATCATCTGCTCGTCCCAGGGAGCGGAAGCCGGAGTAGACAGTTTCAGAGCCAGTGCTCCT
TTTTCTCTGTCTGGCACGGGGGGGGTCGACGAGATGTGGGTTTGATTCCTGGTCCTAGAGCTCGATATGAGTCACGGAGG
GCCAGCTTCTGTACCTCGGCTGCTTACGATGGTCGTGAGGTGAAATGAGCCTCGCCTGTCGGTGGTGTTGAATCCAGCAC
AGAGATCGTCCCGGCGACTTTCCGGTCCTGCATTTGGACGGTTGTTTCAAAGCTCCTTCTTACTTCTGCTCACCAC
Sequence Type genomic DNA
Unitrap ID UNI27887

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155243724..155244197 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029034 (Cpsf3l) NM_028020 cleavage and polyadenylation specific factor 3-like Gene [Source:MGI (curated);Acc:Cpsf3l-001]

 
Come back to gene ENSMUSG00000029034


For any suggestions or comments, please send an email to unitrap@crg.es