Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D155B07
Clone ID D155B07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD155B07
Sequence
GATCCTTCTCAGCAGGAGTGGAAGTAGCTTACAGGGTAAGGACCGTACTCACTGAGCTGTCTCCTAGCCTTGTGGGTGGA
TGGACTTCGTAGTTCTCAATGTAGTGACTCTCTTTATGTGAAACAACTCAAGTCCA
Sequence Type genomic DNA
Unitrap ID UNI19146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42194472..42194607 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038302 (Lace1) NM_145743 lactation elevated 1 Gene [Source:MGI (curated);Acc:Lace1-001]


SPLK-Sequence tag 3SD155B07
Sequence
TCAAATCCATTTGTTATTATTAGCATGTATTATTAGAGATGAGCATTCTTTACCCCACCCCACCCCCTTTGTTTTGTTTT
AAAGACAG
Sequence Type genomic DNA
Unitrap ID UNI19146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42194179..42194266 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038302 (Lace1) NM_145743 lactation elevated 1 Gene [Source:MGI (curated);Acc:Lace1-001]

 
Come back to gene ENSMUSG00000038302


For any suggestions or comments, please send an email to unitrap@crg.es