Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065F05
Clone ID D065F05
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D065F05
Sequence
TTCTCAAGATGGCGGACCTTCTGGGCTCCATCCTGAGCTCCATGGAGAAACCACCCACCCTCGGTGACCAGGAGAGTCGG
CGCAAGGCCCGAG
Sequence Type mRNA
Unitrap ID UNI10427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70482699..70482791 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018287 (Spag7) NM_172561 sperm associated antigen 7 Gene [Source:MGI (curated);Acc:Spag7-001]

 
Come back to gene ENSMUSG00000018287


For any suggestions or comments, please send an email to unitrap@crg.es