Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D154G02
Clone ID D154G02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD154G02
Sequence
TAGTTAACTGTAGGCCAATAAGCATCGTCGANNNNNGGCCTTTCCCGAAAGTGTTNNAGAGCTGGAACTCTCAATCCTAC
GAACGAGGTTTCTGGAGGAATATGGCAGCAAAGGACACGACGTCACTTCCTACTACATTGACGGAAGTGGCTTCCCCGCC
CGCACGTCACAATACTCAGTTGTGTGATCCGGCGTCTTNNNGGCGAAATAGACTGGTGTCGACACTAGTCGGAGAGTGGC
TATGGCGGCGGTGGATTCGGACGTTGTATCGCTGCCGCGTGGCCGCTTTCGCTGCTGCCTCTGCGATGTTACTACAGCCA
ACCGTAAGCGGTGGCTAGTGAGGGAGGAGGGTGGGTGCTAGTGAAAGTTAGGGTTATCTAGGTTATGTGTTTTTGGTGTT
TTTGTTTTTGAAAATAGGGTCATCCACCTATTTTCACTCATCATATCCTAGGGCACTGGAGAGTGGGGAAAAATCTGACC
TGTGGTTCCTGCTATGGAAAATCTCCATAGTGAAAGTTTCATTATTCCCTTTAAAATCATCACCCGCTGTCCATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD154G02
Sequence
ATCCCTTCTGGTTTCTGGTACTTCTGCTGGTCTCTGGAGTAGGGAAGGCGATTTAGGAACTCATTGTTTGGCCTGAGGTA
GTTTCAGTACACCACGGGTATGTTCACAGAGAAGGCAGTAATTCAGTCGGAGACTCCCCAATGGAGGCTTTCTCTAGAGG
CGAGGATGAGTGAAATAGCGTGATCTGAATGAGGGCCGAAGGTGCCAGTGAGGAAAAGGTGTAGGGAAGGTGGACTAGAT
CATTCTGTGACATTGTGAACGACTCAATGACACATCAG
Sequence Type genomic DNA
Unitrap ID UNI11442

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9028741..9029017 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071645 (Tut1) NM_197993 terminal uridylyl transferase 1, U6 snRNA-specific Gene [Source:MGI Symbol;Acc:MGI:1917294]

 
Come back to gene ENSMUSG00000071645


For any suggestions or comments, please send an email to unitrap@crg.es