Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D153H06
Clone ID D153H06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD153H06
Sequence
GGAACCGGAGTACTGGGTATTCTCAGCTGGGCTAATTCCCTTCAGTAGCTTTTGATTAGCTATTTTGCATTCAGTATTTT
AAGATTCAAGTTTTATTATATTTTAGCATTTGTGCAGCATTTATAAACATTTGATGTGTTTTCTTACTGTG
Sequence Type genomic DNA
Unitrap ID UNI7776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134805891..134806041 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es