Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D065D10
Clone ID D065D10
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D065D10
Sequence
GGCCNNNNATTNNNTCTGTGGGCAAACCAATCAAGCTTCTGGCCAATTGCTTTGAGGTGGACATTCCTAAGATTGACGTT
TACCATTACGAGGTGGACATCAAACCGGATAAGTGTCCTCGCAGAGTCAACCG
Sequence Type mRNA
Unitrap ID UNI10430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126140916..126141033 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]


SPLK-Sequence tag 3SD065D10
Sequence
ACACATATAATATTAATGTACAATACTATATACTTTGTTCAATATTGTCCATTTTTTTCTGTTTAGCCACATATATTGGA
AAATAGCGTATATTAGTTTATTTAG
Sequence Type genomic DNA
Unitrap ID UNI10430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126139789..126139893 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es