Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D153F04
Clone ID D153F04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD153F04
Sequence
GCATCTCTGGGAAGACCCCCANTGATACCTACCTGGACGCCATGATAAACGAGGCCCTGAGCCCCNTCAATTTCACCATG
TTCCTCACAATGTTTGGAGAGAAACTGAATGGAACTGACCCCAAGGACGTCATCAGAAATGCCTTTTCTTGCTTCGATGA
GGAAGCCACAGGCACCATCCAGGAGGATTACCTGAGGGAGCTGCTGACCACCATGGGCGACCGCTTCACAGACGAGGAGG
TGGATGAGCTGTACAGAGAGGCCCCCATTGACAAAAAGGGGAACTTCAACTACATTGAGTTCACACGTATCCTGAAGCAC
GGAGCAAAAGACAAAGATGACTGAAGAGCTGCGGCTGCTGACACGCCTCTTGTGTTTGCTTGCTCACTTCCTGTCTCAGA
CACACACACCCAATAGGACCTACTGCGTGCCACTTAGTTTCTCAGTCACTTCTCCTCCCCCATAGGACCTACTGCGTGCC
ACTTAGTTCAGAGCTTTTCCTCTTTTTTTAAATGTATTTATTCCAGACCCTTTCTGTCACTTAGCATGTGTATAATCAGA
CTGGAACGGAGGGCAATGTTGTAAATTGTACTGAAAACGAGATGCAAATAAAAAATGAACCACTCTGAAAGCCCAGGACA
ATATAT
Sequence Type genomic DNA
Unitrap ID UNI14525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3156025..3156670 628
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]


SPLK-Sequence tag 3SD153F04
Sequence
CAGTAAGGAAATCTGAAGGACCATATTAAGTATCCACTAGACTTTTCACAGGGTTAAATTATTCATTGGGTTGGCTGTAA
ACAGCATTAAATGGGGGGCCTAAGGATTTTATTTTTCACTTATATGTAAAACTTTTAAAATGTATTTTAAAATCTGTACT
TTAAAACAAGAAAC
Sequence Type genomic DNA
Unitrap ID UNI14525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3156706..3156879 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es