Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D153C08
Clone ID D153C08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD153C08
Sequence
GATCTAGGACCCCAAAGCCCTTTTGATGATGAAGCCATGAGTCCAAGGCCCTGTGTCCTTCCAAGTAATGTTTCCAATAT
CCAAGCATCCTGTTCTACTGTGTTGGGAC
Sequence Type genomic DNA
Unitrap ID UNI11774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53068836..53068944 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003269 (Pscd2) NP_035311 cytohesin 2 Gene [Source:MGI (curated);Acc:Pscd2-001]


SPLK-Sequence tag 3SD153C08
Sequence
GGACTCAGTTTTACTCCCTCTCCTCAGACTTTTGGTACCCATTCCTCTTCTGGACAGGAATCCAGGCCCCCAGCCCAAAT
CCTTTCTCAGGATGCAGGAGTCCTGACCCCCAGAACTAATTTCTTGACCCTGGTCCCCAGAGCCCCCAGACTTGACTCCA
GAGGAGCGCATGGAGTTGGAGAACATCCGGCGGCGCAAGCAGGAGCTGCTGGTGGAG
Sequence Type genomic DNA
Unitrap ID UNI11774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53068450..53068666 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003269 (Pscd2) NP_035311 cytohesin 2 Gene [Source:MGI (curated);Acc:Pscd2-001]

 
Come back to gene ENSMUSG00000003269


For any suggestions or comments, please send an email to unitrap@crg.es