Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D153B09
Clone ID D153B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD153B09
Sequence
GGGGGAAAAGTGCTCAGAATTGTTATGGCTGGTTCGTCCATTTAGGTAGAAGGTTATAAAGGATTTGAAGACACTCAGTA
TGAGACTTGATTTAGTAAATGAGCATCCAAATTCTCTTGTCCAAAAAGAAATTAAGTTACCTGACTGGGTTCAGATAGGT
TTTCTTTAATATGGTGACCACACATGATATTGTAAGCTGATAACTGCATTTGATGCAGCTAAACCCACTGCAGAACAAGA
TTAAATAAAATGCAAAGAAGCCTAGTTTAAAATCCCCTCCAAACCTTCGGTTTTGTGGGAGTGCTTGATTTACATATTTC
TGCTGTTCTAAGGAACTGCCGACTCCTGCTGTGTTGCTGTGGGGTCACCT
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102931968..102932337 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]


SPLK-Sequence tag 3SD153B09
Sequence
ACCTGTCCTGTCTTGGCTCTTCACGCTCTCCTGAGCCCTTCAGTCTCTTTAATTGCTATAGAAGTTGTTGGCTCCTGTGG
TTTTAAGATGCAGCATTCAAACTGTTGGGTCCTCTCAGTGCTTGTGCTTCTGAAAGCAGGCTTGAAAAAGCATCGTATGG
GAAATGTAAACAAGTTGGCTGCTCTTAGAGAGTTTTTTAAAGGATGAAGGTTGGAAGAGACCTTGGAAACTAGCCCTCCT
TTATGGGTGGAAG
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102932334..102932585 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es