Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D153B07
Clone ID D153B07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD153B07
Sequence
TCTCCATGGCTTNNNCGAGCGACTCCCGCAAGGCGCCAGCAGCAAAGCACGGCCTGACAGCGCGTCGCCCTTCTCGCGCG
TCAGTTCNNNCGTCTCCGGCGTGCGTGGCGTCACTCGTCGGCGCCGGAAATCGAGTGCGCCTTGGCCCGTGGGCGGCGCT
TCACGGAGGCGTAGAGAAGCAATGGCCGCTGACGGTGAGGGTGGCATGGATCGAAACGCGGAGCCGGGCGGGAGGGATAC
TTTTGGTCTTTAGAGGCACAGCCAGTGT
Sequence Type genomic DNA
Unitrap ID UNI11900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125029017..125029284 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029387 (Gtf2h3) NM_181410 general transcription factor IIH, polypeptide 3 Gene [Source:MGI (curated);Acc:Gtf2h3-001]

 
Come back to gene ENSMUSG00000029387


For any suggestions or comments, please send an email to unitrap@crg.es