Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D153B05
Clone ID D153B05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD153B05
Sequence
AACGTGAACTGAAACTGTTTGATAAGTTTTTTCCATATTTGAAGTTATGCAGTAATGTCATCTTGAGGTACATTAAGTAG
TGTTTACAAATTGAGTAGTTTTTTTCTGCATACTTACATTTTGTACTAGTATTTTACAAATATGTAATTTCCTTTCCTTA
AACTTTTACTTTGAAAATCATATGGAAAAACAAAAGAATGTTCAATACTCAATATATTTTACCTTGTTTTTATATTTTGT
CAGATTTGTTTTATGTGAATTCTTTGCTTAATCACGTAAAAGGAAGTTACAGGTAGTGAGATATATCACTTGTAAATACT
TTTCTTATTTTAATTCTAAGCATAAAGATATTTACGGTATGTTTTGTACTTTTGTTGTTTTAAATGTATATGATTACTCT
GTCACTATCTT
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21157041..21157451 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


SPLK-Sequence tag 3SD153B05
Sequence
GCTTTTAAGTGGTGGGCACTTAACAAATTTAGCCCAAAAGGACTTATTAAAATCAATAGGTACCCGGATTAGTTTTCTAA
AAGCCTAAGGGTTTGGATTGGGTGGTTCCCCCCTAAAGGGCTAAAATGGAAACCCCCGGTTTCCGGTAATAATAATAATT
TT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es