Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D153B02
Clone ID D153B02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD153B02
Sequence
GTGAAGCCGAGGTGAGTCTTCGTCTTTACATATGGGGCCTTTCTCCACCACTGCCTGGTATTCAGCAAAGCCCCCGCTAG
GACAAACCCGGCCGGTCTCAGGATGTGCGTGCAAAGGTTTGCTAGCCTCACGTCATTTGAACCAGGCCCCTCTGCTGGCC
TGGCCTGCTCAGCACAAAGGGCAGGGCTTTTCCCAGCCTAAAGCTACAGCATGCCTGAGTGAAGGTTGTCCTCAGGGAGC
TAGGCAGACTCCGGTGAGAGGAGACCACCGTCTGTGGCCGCTTCCGAGCGTGTGAGCGGAGCGTGCGTGCTTGTGGTGGG
TACAGGCAGGGCCTGTGTTTTAAAGGTTTTCAGTGCTGTCCTGTGGAGATGGCTGCCTTTCCTCCTGGTGCTTGGGGTCA
GTTTGCTGGTGTGAGAGACCTGGGTCGGCTCTTTAGACCGTTCTCTGTCTCCTCTGTGCCTGATCGTTAGAGCCTGCCTA
AGCCGGAAGGAGCGTCTGCTTTTCTGAGTGACTCTCACCTTGACCTTGACCTTGCTCTGGAATGGGGGTGGCGAGACAAG
CTTTTTGGGGATTCTGCAATGGATGCACTTTCTCTCCAGAATCCA
Sequence Type genomic DNA
Unitrap ID UNI30018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28264024..28264628 605
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031488 (Rab11fip1) NM_001080813 RAB11 family interacting protein 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:1923017]

 
Come back to gene ENSMUSG00000031488


For any suggestions or comments, please send an email to unitrap@crg.es