Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D152H02
Clone ID D152H02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD152H02
Sequence
CACAGTGCACATATATTCAATGCACACCCATGTATGCACACAGTGGACATAT
Sequence Type genomic DNA
Unitrap ID UNI30019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70258331..70258382 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042064 (Myo3b) NM_177376 myosin IIIB Gene [Source:MGI (curated);Acc:Myo3b-002]

 
Come back to gene ENSMUSG00000042064


For any suggestions or comments, please send an email to unitrap@crg.es