Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D152F09
Clone ID D152F09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD152F09
Sequence
GATCCTAGCTTTGCCCCAATAGCTGCTGCTATCATCAGCTGACCGGCTGTGGGCAGTGGTTACCAGGGCAACGGCAAGGC
TGCCTAGGTAGGCAAGTCTGCAGCCGACATAGAGGTGGGGAAGAGGCCAGTTAGTGCTAATAGGGGTTAGAGGGCTAGGC
TTTCTAGATGCACCCCAAAGCCAACGTTGGAGGCCTGGAATGGTTGAAGTTTTGCCACAGAGAGAAGGCATGTCTCTTTG
GAAT
Sequence Type genomic DNA
Unitrap ID UNI30020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71027527..71027770 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


SPLK-Sequence tag 3SD152F09
Sequence
GGAATATGGATGCCATCTGATAGAAAGCTTCCTTTTGCAAAAACAGCTTTCCTGGGAAAAATCGGTCCTTCATTCTCTCC
CTGGCCCCTACTACGATCCCCAGGGGATCAAGTTTACAGAAAATCCAATCTGAATCTGATGTATTTATGACCTGGTTCCT
TCCATCCTTCTATCTGTCCTCCTCAGAGAGGGTTAATGTTTGGATGGCCAATTCGGGTGCCCCTGCTGTTCCCCGTCCCA
GAGGTGGGGGG
Sequence Type genomic DNA
Unitrap ID UNI30020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71027281..71027531 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es