Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D152B07
Clone ID D152B07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD152B07
Sequence
CTAACTGTGCAGAANNNGAATGGAATAACTTGCCACATCTGTAGAGGTGCCCCCTGCCCTAGGTAGAGCCCCCTTGGATG
AACAGTGTCTTAAGGTCTAGGAACTGTTACTGGAATGAGCTGATGTAGGTCCTTTTATAGGAAATCAAGTAGGAGGTTAT
GAACTAAGTTTTTTGCAAGTTAAAGGGGTGACAGTGAAATGAAAGAAAAAAAAAACAACTATGTGTTATTGAAGTTTGTA
TAAAAGATATAAATTTAGAGGGAGAGTGTCAAGCAGAAACAAAGAGATGGAAGGTATATCAGACNNNAATATTGTAAAAA
AATGTAATTCCCTTTATTTATTTCTCTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD152B07
Sequence
TCATAGTTGAGCCTTTACTGTTTTTCTAATTACTAAGAACTGGTAGTTTTACCTTCTAAGGAACCCTTTTAATCTGTAAT
GACACAGTGCATGCTGACGTCGCTTCTCACCTAGTTTACCACAGGACCCTTTTCCCTTCTAGATTCACCTCTAGATTCCG
TAGCTTCTCCATGGCAACTGCAGTGTTTCTGAGCAGTGAATCAATCACTCTAGTTCAAAAAGCTTTCAATGGCTNNNCCT
ACAGTCTTCACTAGGAGAGGCAGCATGCTAGAGGG
Sequence Type genomic DNA
Unitrap ID UNI15611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53985548..53985822 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es