Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D152A09
Clone ID D152A09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD152A09
Sequence
GATCTGACTCCCTCTTCTAGAGTGTCTGAAGATAGCTACAGTGTACTTACATATAATAAATAAACAAATCTTAAAAAAAA
GAATATAAAACTGCTTCCTTCC
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109143206..109143307 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]


SPLK-Sequence tag 3SD152A09
Sequence
CCAACAGGCCTTGGATAGTTTTGTCTGTGGGAACAGCTTCCCATAGGAAAGGTGCTTTTGCTACTTCCGACCGTCACACA
CTCCTCCTCTGCACCCCGTGANNNCCTCCCAGGAGTTTTGTGTTGGTCACAAGCCTCCCCATGTCCCAAGGGGGTCTGGA
GAGGG
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109143307..109143471 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es