Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D151G09
Clone ID D151G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD151G09
Sequence
GTTCTCAGCTGTGACCTTAATTCCTTAGTGCGACTTTTAAAATTAACTTTGGCAGCGCTGAGCCGAACCTTGCGGCCTCT
CGCGTTACTAAGCAAGCACTGCCATTGAACTGCACACACCCATCTTTTTCAAAACAAAAAAATTTTTTTTTTCTTGAAAT
GGAGCCATTCATACACTTCCCACCCTCCGCCCCGCACCACCCTCCTTCCTGCTTCTGTTCCCCGGTCCAGGTGTGCGCCG
CTGGGACGGCCACTCGGGGGTTTCTGAGCAAGAGAATAGCGGCAGCCACATGATGTTTGCATTTGGGAAGTGAGCGCTCT
GCGCAGTGCTGACCCTTATCTATCACCCTTGACTGATGGCTGACGTTGGGGATCACCACCGTGAGGTGGCAGGAGAAAGC
GCAGTCTCTGTCTTCCCTTGTCCTTTGTGTCTCAACCCTCGTGTGAGTCGTTAGTCACGCTCATTTTACTGCGGTCTCCC
AGTTGGCTCCTGCCTGTCGAAGTGTGTGTTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379339..35379850 512
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075770 (SNORD83)  


SPLK-Sequence tag 3SD151G09
Sequence
GTCCCCTCTCCCGGCACATCTGTCGGAAACTGGTGTCTTTCCCCTTGCTGTTCTTCAACCCCTCTCTTTGGCCCTTGCTT
CCTCACCTGCTCTGGGACACCTAACTCAAGAGACCTCCCTTCTCCCCCTGCCGGCCCAATTATGGCAGAGAACGATGTGG
ACAATGAGCTCTTGGACTACGAAGACGACGAGGTGGAGACAGCCGCTGGGGCAGATGGGACCGAGGCTCCCGCCAAGAAA
GACGTCAAGGGCTCCTACGTCTCCATCCACAGCTCCGGCTTCCGAGATTTTCTACTCAAGCCAGAGCTGCTCCGGGCCAT
CGTTGACTGTGGCTTTGAGCATCC
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35380044..35380387 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es