Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D151E12
Clone ID D151E12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD151E12
Sequence
GCTCCACCGCACGCATGGGCTCCCCAGAAACCAGAGAANNNTAAATGAAGTCCTAGGCTCCTTAAATCACCAGTGGGCAA
ACTTAAGCCATATGCTAGCGGATCAAAAAGCACAGTTATCTGTCCCATGTTTGACTGCCTTGCTCTGCGACAGGTTCTCT
CTCCTGCTGTCACTTNGTCTCTTCTCGTGTAATGCACACATGCTGAGATTCTGTGTTCTATTCACCAGCTTGTGTGAGTT
CGTAAAGCTGGAGGAATCAGGTGTTGGTGAGTCTGCGGAGCTGGTTGGTGGGACTGCAATACCACGGCTGCTTGNNAGAC
AGCTCGGCTCATTCTAGTAAAAGCAAGAGTTGCACGTGCCTGTATGTGTACGTGCAGGGCCACAGGCCAGTGTTCGTAAT
GTCCAAACTTAATCCCACAGGGCCATCAGAGTAGGAACAGCAGTGACATGAGCAAAACAAGCACAGTCACATGAGTGAAA
CTCACTGCCATGTTAGTCTAAAAAGAGGGGAGGGG
Sequence Type genomic DNA
Unitrap ID UNI23296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36980470..36980982 473
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024457 (Trim26) NM_001025599 tripartite motif-containing 26 Gene [Source:MGI Symbol;Acc:MGI:1337056]

 
Come back to gene ENSMUSG00000024457


For any suggestions or comments, please send an email to unitrap@crg.es