Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D150G09
Clone ID D150G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD150G09
Sequence
AGACGAAGGTGAAAGTTAAAATAGGAACAAAACAAAGCCGGGAGAGCTAACTAAACTCAGCAGCTGGCCAGTGGGGAGGA
CAGCAGGAAGACAGCAATCCATACATAGCAGGGGCCCAGAATGGTGACCGAGTGGCTGAGCCTGGAGAACAGCATTATGG
GGAATGGCAGAGCTGCTGCCTCCAGGCACTCAGTGCTTTAGAACACTGTGACTGGTTCAGGGAACCCGAGGGCCTCAGCA
CATTCCTTTTGCACTAGAAATAACAGTGTAAACAGTGCCCCCTCCCACTGCGTGT
Sequence Type genomic DNA
Unitrap ID UNI30027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 65196360..65196654 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024589 (Nedd4l) NM_031881 neural precursor cell expressed, developmentally down-regulated gene 4-like Gene [Source:MGI Symbol;Acc:MGI:1933754]

 
Come back to gene ENSMUSG00000024589


For any suggestions or comments, please send an email to unitrap@crg.es