Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D150E11
Clone ID D150E11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD150E11
Sequence
TATCACTAAAAATATGCCTCTAACTTAAGAGCAGACATGTGTCTGGTTTTGGTAAATAGTTGCAAAAATGTCCCCAACCC
TGTGGGAACTCTTAAGGGGAGTCCCAGTTGTGCTGTGCTAAGTG
Sequence Type genomic DNA
Unitrap ID UNI6870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29204070..29204194 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037513 (Samd4b) NM_175021 sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2448542]

 
Come back to gene ENSMUSG00000037513


For any suggestions or comments, please send an email to unitrap@crg.es