Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D150A02
Clone ID D150A02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD150A02
Sequence
GATCTGGGTTAATAGAAGCGGCCCCTTTAAGAACTTTGTTGGCCCGCCCTCAAAAGGGATCAGCAGGAAAGGAGTCATGT
GACTCTGAGGCTCTTCCGCTGAGTTTAACTAGCTGTGGCTGTATGTTTCGCTGTTGGGGACCTCACTGGGGCTGGGTCCC
CTGTGCCCCTACCCCATGGCTCCTTTTGAGTCTACTTGTGTGTTCAGCTCCATTTGGCCTGCAGGGAGAAGAGACTCGCC
AGGTAAGGGCTCTGGAACTGAAGTTATAGATGTTTCCGGAAATCCTACCTTTCTAGGATGACCGGAATCTGGGACAACAG
AGGGGTGGAAGGTGGATGCAAGAGAGATAACAACCCAGAGAGCTCAGTGTGGAGTCACGAGTGATTGGAAGAATTGTGGA
GGGGTCAGGCATGACTGCGTCCTGCTTTCTGACGATGTCTGAGCCATGGCTCAGCCATTGTAGCCCAGGAACAGGCAAGT
TTGGGGACTTAAAAGCCTTGTTAGCTCT
Sequence Type genomic DNA
Unitrap ID UNI11512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88128882..88129389 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001418 (0610031J06Rik) NM_020003 RIKEN cDNA 0610031J06 gene Gene [Source:MGI Symbol;Acc:MGI:1913318]

 
Come back to gene ENSMUSG00000001418


For any suggestions or comments, please send an email to unitrap@crg.es